Stem-loop sequence hsa-mir-4744

AccessionMI0017382 (change log)
Symbol HGNC:MIR4744
DescriptionHomo sapiens miR-4744 stem-loop
Stem-loop
          c               uuc       -ccag  c 
5' guaauca aucuaaagacuagac   gcuauga     gc a
   ||||||| |||||||||||||||   |||||||     ||  
3' cauuagu uggauuucugaucug   ugauacu     ug u
          u               -ua       acaaa  a 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 49049687-49049768 [-]
antisense
OTTHUMT00000447677 ; RP11-267C16.1-004; intron 1
OTTHUMT00000447679 ; RP11-267C16.1-003; intron 1
OTTHUMT00000447680 ; RP11-267C16.1-002; intron 1
OTTHUMT00000447681 ; RP11-267C16.1-005; intron 1
OTTHUMT00000448258 ; RP11-267C16.1-006; intron 3
ENST00000583982 ; RP11-267C16.1-004; intron 1
ENST00000583609 ; RP11-267C16.1-003; intron 1
ENST00000435144 ; RP11-267C16.1-002; intron 1
ENST00000580841 ; RP11-267C16.1-005; intron 1
ENST00000582689 ; RP11-267C16.1-006; intron 3
Database links

Mature sequence hsa-miR-4744

Accession MIMAT0019875
Sequence

10 - 

ucuaaagacuagacuucgcuaug

 - 32

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).