Stem-loop sequence hsa-mir-4743

AccessionMI0017381 (change log)
Symbol HGNC:MIR4743
DescriptionHomo sapiens miR-4743 stem-loop
Gene family MIPF0001384; mir-4743
Stem-loop
   g    -     ug        -     --   u  g 
5'  cugg ccgga  ggacagga ggcau  gaa ga c
    |||| |||||  |||||||| |||||  ||| ||  
3'  gacc ggucu  ucugucuu ccgua  cuu cu c
   -    u     uu        u     ac   u  a 
Get sequence
Deep sequencing
161 reads, 0 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 48670600-48670668 [+]
intergenic
Database links

Mature sequence hsa-miR-4743-5p

Accession MIMAT0019874
Previous IDshsa-miR-4743
Sequence

3 - 

uggccggaugggacaggaggcau

 - 25

Get sequence
Deep sequencing145 reads, 35 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence hsa-miR-4743-3p

Accession MIMAT0022978
Sequence

49 - 

uuucugucuuuucugguccag

 - 69

Get sequence
Deep sequencing14 reads, 13 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).