Stem-loop sequence hsa-mir-4742

AccessionMI0017380 (change log)
Symbol HGNC:MIR4742
DescriptionHomo sapiens miR-4742 stem-loop
Gene family MIPF0001552; mir-4742
Literature search

1 open access papers mention hsa-mir-4742
(1 sentences)

Stem-loop
   --u          -  uauu        c   uuaa         ga 
5'    caggcaaagg ga    uacagaua uuu    aauuuguuu  g
      |||||||||| ||    |||||||| |||    |||||||||   
3'    guccguuucc cu    augucuau aaa    uuagacgga  u
   gac          u  ---u        -   ----         gu 
Get sequence
Deep sequencing
611 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 224398227-224398311 [-]
sense
OTTHUMT00000091467 ; RP11-365O16.3-001; intron 1
ENST00000436706 ; RP11-365O16.3-001; intron 1
Database links

Mature sequence hsa-miR-4742-5p

Accession MIMAT0019872
Sequence

1 - 

ucaggcaaagggauauuuacaga

 - 23

Get sequence
Deep sequencing196 reads, 73 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-4742-3p

Accession MIMAT0019873
Sequence

63 - 

ucuguauucuccuuugccugcag

 - 85

Get sequence
Deep sequencing409 reads, 63 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).