Stem-loop sequence hsa-mir-4741

AccessionMI0017379 (change log)
Symbol HGNC:MIR4741
DescriptionHomo sapiens miR-4741 stem-loop
Literature search

4 open access papers mention hsa-mir-4741
(5 sentences)

Stem-loop
      gcg   cg  u      g      ---     ---------      ca 
5' cgg   ggg  gg ccggcc ccuccg   agccc         ggccgg  g
   |||   |||  || |||||| ||||||   |||||         ||||||   
3' gcc   ccc  uc ggcugg ggaggc   ucggg         ccggcc  c
      --a   uu  -      -      cug     cgcgaaauu      cc 
Get sequence
Deep sequencing
900 reads, 0 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 22933349-22933438 [+]
intergenic
Database links

Mature sequence hsa-miR-4741

Accession MIMAT0019871
Sequence

59 - 

cgggcuguccggaggggucggcu

 - 81

Get sequence
Deep sequencing846 reads, 55 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).