Stem-loop sequence hsa-mir-4740

AccessionMI0017378 (change log)
Symbol HGNC:MIR4740
DescriptionHomo sapiens miR-4740 stem-loop
Literature search

1 open access papers mention hsa-mir-4740
(1 sentences)

Stem-loop
   gc  a    u             a  gag  a 
5'   ca ggac gauccucucgggc gg   uc g
     || |||| ||||||||||||| ||   || a
3'   gu ccug cuaggagagcccg cc   gg g
   -c  c    c             -  --a  g 
Get sequence
Deep sequencing
36 reads, 26.9 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 81400716-81400778 [-]
intergenic
Database links

Mature sequence hsa-miR-4740-5p

Accession MIMAT0019869
Sequence

5 - 

aggacugauccucucgggcagg

 - 26

Get sequence
Deep sequencing31 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4740-3p

Accession MIMAT0019870
Sequence

42 - 

gcccgagaggauccgucccugc

 - 63

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).