Stem-loop sequence hsa-mir-4738

AccessionMI0017376 (change log)
Symbol HGNC:MIR4738
DescriptionHomo sapiens miR-4738 stem-loop
Gene family MIPF0001521; mir-4738
Literature search

1 open access papers mention hsa-mir-4738
(2 sentences)

Stem-loop
       g a        ucuua    c      u         a    a 
5' gguc c uuucuccu     ccag gcguuu caguuucau ggga g
   |||| | ||||||||     |||| |||||| ||||||||| |||| c
3' ccgg g gaagagga     gguc cgcgag gucaaagua ccuu c
       - -        -----    -      -         -    u 
Get sequence
Deep sequencing
182 reads, 3.51 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 75784521-75784607 [-]
intergenic
Database links

Mature sequence hsa-miR-4738-5p

Accession MIMAT0019866
Sequence

20 - 

accagcgcguuuucaguuucau

 - 41

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4738-3p

Accession MIMAT0019867
Sequence

57 - 

ugaaacuggagcgccuggagga

 - 78

Get sequence
Deep sequencing149 reads, 47 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).