![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4737 |
|||||
Accession | MI0017374 (change log) | ||||
Symbol | HGNC:MIR4737 | ||||
Description | Homo sapiens miR-4737 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-4737 | ||||
Stem-loop |
cugcaca a c a a - acag g 5' gg ug gagg ugcug cagug ccuc cc c || || |||| ||||| ||||| |||| || a 3' cc ac cucc guggc gucgu ggag gg c -gacaca g a - a a -cca a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4737 |
|
Accession | MIMAT0019863 |
Sequence |
10 - augcgaggaugcugacagug - 29 |
Deep sequencing | 8 reads, 7 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|