Stem-loop sequence hsa-mir-4737

Accession

MI0017374 (change log)

Symbol

HGNC:MIR4737

Description

Homo sapiens miR-4737 stem-loop

Literature search

2 open access papers mention hsa-mir-4737
(5 sentences)

Stem-loop

   cugcaca  a  c    a     a     -    acag  g 
5'        gg ug gagg ugcug cagug ccuc    cc c
          || || |||| ||||| ||||| ||||    || a
3'        cc ac cucc guggc gucgu ggag    gg c
   -gacaca  g  a    -     a     a    -cca  a 

Deep sequencing

16 reads, 0 reads per million, 10 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 60043025-60043105 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000445461 ; MED13-001; intron 19

  ENST00000397786 ; MED13-001; intron 19

Database links

• EntrezGene:MIR4737
• HGNC:MIR4737
• miRBase Tracker:MI0017374

Mature sequence hsa-miR-4737

• Accession: MIMAT0019863
• Sequence: 10 - augcgaggaugcugacagug - 29
• Deep sequencing: 8 reads, 7 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4737
  • TargetScanVert:hsa-miR-4737
  • miRDB:hsa-miR-4737

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).