Stem-loop sequence hsa-mir-4737

AccessionMI0017374 (change log)
Symbol HGNC:MIR4737
DescriptionHomo sapiens miR-4737 stem-loop
Literature search

2 open access papers mention hsa-mir-4737
(5 sentences)

Stem-loop
   cugcaca  a  c    a     a     -    acag  g 
5'        gg ug gagg ugcug cagug ccuc    cc c
          || || |||| ||||| ||||| ||||    || a
3'        cc ac cucc guggc gucgu ggag    gg c
   -gacaca  g  a    -     a     a    -cca  a 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 60043025-60043105 [-]
sense
OTTHUMT00000445461 ; MED13-001; intron 19
ENST00000397786 ; MED13-001; intron 19
Database links

Mature sequence hsa-miR-4737

Accession MIMAT0019863
Sequence

10 - 

augcgaggaugcugacagug

 - 29

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).