Stem-loop sequence hsa-mir-4735

AccessionMI0017372 (change log)
Symbol HGNC:MIR4735
DescriptionHomo sapiens miR-4735 stem-loop
Literature search

1 open access papers mention hsa-mir-4735
(3 sentences)

Stem-loop
   u      c         a      c      ca 
5'  gcagug cuaauuuga caccuu gguauu  u
    |||||| ||||||||| |||||| ||||||  c
3'  cguuac gauuaaacu guggaa ccauaa  a
   a      a         c      a      aa 
Get sequence
Deep sequencing
90 reads, 75 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 196582413-196582481 [-]
intergenic
Database links

Mature sequence hsa-miR-4735-5p

Accession MIMAT0019860
Sequence

8 - 

ccuaauuugaacaccuucggua

 - 29

Get sequence
Deep sequencing17 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4735-3p

Accession MIMAT0019861
Sequence

45 - 

aaaggugcucaaauuagacau

 - 65

Get sequence
Deep sequencing71 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).