Stem-loop sequence hsa-mir-4733

AccessionMI0017370 (change log)
Symbol HGNC:MIR4733
DescriptionHomo sapiens miR-4733 stem-loop
Stem-loop
   gguc                      c      aauca 
5'     gcuuaaaucccaaugcuagacc gguggc     a
       |||||||||||||||||||||| ||||||      
3'     cgaauuuaggguuacgaucugg ccaccg     g
   --cc                      a      aucug 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 31094350-31094425 [-]
sense
OTTHUMT00000447457 ; MYO1D-001; intron 7
OTTHUMT00000447462 ; MYO1D-002; intron 7
OTTHUMT00000447473 ; MYO1D-003; intron 7
OTTHUMT00000447459 ; MYO1D-004; intron 9
ENST00000318217 ; MYO1D-001; intron 7
ENST00000579584 ; MYO1D-002; intron 7
ENST00000583621 ; MYO1D-003; intron 7
ENST00000394649 ; MYO1D-004; intron 9
Database links

Mature sequence hsa-miR-4733-5p

Accession MIMAT0019857
Sequence

10 - 

aaucccaaugcuagacccggug

 - 31

Get sequence
Deep sequencing80 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4733-3p

Accession MIMAT0019858
Sequence

47 - 

ccaccaggucuagcauugggau

 - 68

Get sequence
Deep sequencing29 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).