Stem-loop sequence hsa-mir-4732

AccessionMI0017369 (change log)
Symbol HGNC:MIR4732
DescriptionHomo sapiens miR-4732 stem-loop
Literature search

5 open access papers mention hsa-mir-4732
(61 sentences)

Stem-loop
        a   ----           ---ag    aa    ugu 
5' gaggg gcu    guagagcaggg     cagg  gcug   g
   ||||| |||    |||||||||||     ||||  ||||    
3' cuccc cga    cgucuuguccu     gucc  cgac   u
        -   cccc           gucca    --    cug 
Get sequence
Deep sequencing
560 reads, 1.72 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 28861655-28861730 [-]
antisense
OTTHUMT00000443628 ; ALOX12P1-001; exon 4
ENST00000579299 ; ALOX12P1-001; exon 4
Clustered miRNAs
< 10kb from hsa-mir-4732
hsa-mir-4732chr17: 28861655-28861730 [-]
hsa-mir-144chr17: 28861533-28861618 [-]
hsa-mir-451bchr17: 28861371-28861438 [+]
hsa-mir-451achr17: 28861369-28861440 [-]
Database links

Mature sequence hsa-miR-4732-5p

Accession MIMAT0019855
Sequence

9 - 

uguagagcagggagcaggaagcu

 - 31

Get sequence
Deep sequencing525 reads, 44 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4732-3p

Accession MIMAT0019856
Sequence

43 - 

gcccugaccuguccuguucug

 - 63

Get sequence
Deep sequencing20 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).