Stem-loop sequence hsa-mir-4731

AccessionMI0017368 (change log)
Symbol HGNC:MIR4731
DescriptionHomo sapiens miR-4731 stem-loop
Literature search

2 open access papers mention hsa-mir-4731
(3 sentences)

Stem-loop
              c          a  a     cag 
5' cccugccagug ugggggccac ug gugug   u
   ||||||||||| |||||||||| || |||||    
3' gggacggucac acccccggug ac cacac   c
              a          a  a     cua 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 15251627-15251696 [-]
intergenic
Database links

Mature sequence hsa-miR-4731-5p

Accession MIMAT0019853
Sequence

10 - 

ugcugggggccacaugagugug

 - 31

Get sequence
Deep sequencing45 reads, 28 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4731-3p

Accession MIMAT0019854
Sequence

42 - 

cacacaaguggcccccaacacu

 - 63

Get sequence
Deep sequencing22 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).