Stem-loop sequence hsa-mir-4730

AccessionMI0017367 (change log)
Symbol HGNC:MIR4730
DescriptionHomo sapiens miR-4730 stem-loop
Stem-loop
   -cg       c   c g   c   u   u    ga     
5'    caggccu ugg g agc cau cca gcca  ugcu 
      ||||||| ||| | ||| ||| ||| ||||  ||| g
3'    guccgga acc c ucg gug ggu cggu  gcga 
   gug       c   u g   u   u   -    -a     
Get sequence
Deep sequencing
36 reads, 8.33 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 80419418-80419493 [+]
sense
OTTHUMT00000443568 ; NARF-010; intron 2
OTTHUMT00000443569 ; NARF-006; intron 2
OTTHUMT00000443570 ; NARF-011; intron 2
OTTHUMT00000443571 ; NARF-012; intron 2
OTTHUMT00000443573 ; NARF-001; intron 2
OTTHUMT00000443574 ; NARF-007; intron 2
OTTHUMT00000443575 ; NARF-005; intron 2
OTTHUMT00000443576 ; NARF-004; intron 2
OTTHUMT00000443578 ; NARF-018; intron 2
OTTHUMT00000443579 ; NARF-014; intron 2
OTTHUMT00000443580 ; NARF-003; intron 2
OTTHUMT00000443581 ; NARF-008; intron 2
OTTHUMT00000443582 ; NARF-025; intron 2
OTTHUMT00000443583 ; NARF-020; intron 2
OTTHUMT00000443584 ; NARF-019; intron 2
OTTHUMT00000443585 ; NARF-021; intron 2
OTTHUMT00000443586 ; NARF-015; intron 2
OTTHUMT00000443587 ; NARF-016; intron 2
OTTHUMT00000443572 ; NARF-013; intron 3
ENST00000579198 ; NARF-010; intron 2
ENST00000390006 ; NARF-006; intron 2
ENST00000583181 ; NARF-011; intron 2
ENST00000584192 ; NARF-012; intron 2
ENST00000309794 ; NARF-001; intron 2
ENST00000345415 ; NARF-007; intron 2
ENST00000581202 ; NARF-005; intron 2
ENST00000374611 ; NARF-004; intron 2
ENST00000457415 ; NARF-018; intron 2
ENST00000584411 ; NARF-014; intron 2
ENST00000581795 ; NARF-003; intron 2
ENST00000577812 ; NARF-008; intron 2
ENST00000581743 ; NARF-025; intron 2
ENST00000577432 ; NARF-020; intron 2
ENST00000582907 ; NARF-019; intron 2
ENST00000578082 ; NARF-021; intron 2
ENST00000580748 ; NARF-015; intron 2
ENST00000577410 ; NARF-016; intron 2
ENST00000412079 ; NARF-201; intron 2
ENST00000580296 ; NARF-013; intron 3
Database links

Mature sequence hsa-miR-4730

Accession MIMAT0019852
Sequence

10 - 

cuggcggagcccauuccaugcca

 - 32

Get sequence
Deep sequencing30 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).