Stem-loop sequence hsa-mir-4729

AccessionMI0017366 (change log)
Symbol HGNC:MIR4729
DescriptionHomo sapiens miR-4729 stem-loop
Literature search

1 open access papers mention hsa-mir-4729
(2 sentences)

Stem-loop
                             a     cug 
5' ucuguuuccucauuuaucuguuggga gcuaa   u
   |||||||||||||||||||||||||| |||||    
3' agacaaaggaguaaauagacgacccu cgauu   g
                             g     cca 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 59366083-59366154 [+]
sense
OTTHUMT00000449596 ; BCAS3-008; intron 1
OTTHUMT00000449597 ; BCAS3-031; intron 1
OTTHUMT00000449598 ; BCAS3-009; intron 1
OTTHUMT00000449599 ; BCAS3-033; intron 1
OTTHUMT00000449594 ; BCAS3-032; intron 2
OTTHUMT00000449592 ; BCAS3-028; intron 7
OTTHUMT00000449586 ; BCAS3-006; intron 14
OTTHUMT00000449585 ; BCAS3-005; intron 15
OTTHUMT00000449582 ; BCAS3-013; intron 21
OTTHUMT00000449571 ; BCAS3-004; intron 22
OTTHUMT00000449575 ; BCAS3-002; intron 22
OTTHUMT00000449581 ; BCAS3-012; intron 22
OTTHUMT00000449578 ; BCAS3-001; intron 23
ENST00000585812 ; BCAS3-008; intron 1
ENST00000587294 ; BCAS3-031; intron 1
ENST00000592702 ; BCAS3-009; intron 1
ENST00000588569 ; BCAS3-033; intron 1
ENST00000587002 ; BCAS3-032; intron 2
ENST00000585979 ; BCAS3-028; intron 7
ENST00000588874 ; BCAS3-006; intron 14
ENST00000585744 ; BCAS3-005; intron 15
ENST00000408905 ; BCAS3-013; intron 21
ENST00000589222 ; BCAS3-004; intron 22
ENST00000407086 ; BCAS3-002; intron 22
ENST00000588462 ; BCAS3-012; intron 22
ENST00000390652 ; BCAS3-001; intron 23
Database links

Mature sequence hsa-miR-4729

Accession MIMAT0019851
Sequence

10 - 

ucauuuaucuguugggaagcua

 - 31

Get sequence
Deep sequencing13 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).