Stem-loop sequence hsa-mir-4727

AccessionMI0017364 (change log)
Symbol HGNC:MIR4727
DescriptionHomo sapiens miR-4727 stem-loop
Literature search

2 open access papers mention hsa-mir-4727
(5 sentences)

Stem-loop
   -               -  a    cag 
5'  aaucugccagcuucc ac gugg   a
    ||||||||||||||| || ||||   u
3'  uuagacggucgaagg ug uacc   u
   c               g  a    cuu 
Get sequence
Deep sequencing
126 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 38825838-38825892 [+]
intergenic
Database links

Mature sequence hsa-miR-4727-5p

Accession MIMAT0019847
Sequence

2 - 

aucugccagcuuccacagugg

 - 22

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4727-3p

Accession MIMAT0019848
Sequence

34 - 

auagugggaagcuggcagauuc

 - 55

Get sequence
Deep sequencing121 reads, 39 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).