Stem-loop sequence hsa-mir-4726

AccessionMI0017363 (change log)
Symbol HGNC:MIR4726
DescriptionHomo sapiens miR-4726 stem-loop
Literature search

1 open access papers mention hsa-mir-4726
(2 sentences)

Stem-loop
   -ag         -       a  --       
5'    ggccagagg agccugg gu  ggucgg 
      ||||||||| ||||||| ||  ||||| g
3'    ccggucucc uuggacc ca  ucagcu 
   acg         c       -  ag       
Get sequence
Deep sequencing
87 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 38719691-38719748 [+]
antisense
OTTHUMT00000257222 ; CCR7-001; intron 1
OTTHUMT00000447527 ; CCR7-003; intron 1
ENST00000246657 ; CCR7-001; intron 1
ENST00000578085 ; CCR7-003; intron 1
Database links

Mature sequence hsa-miR-4726-5p

Accession MIMAT0019845
Sequence

1 - 

agggccagaggagccuggagugg

 - 23

Get sequence
Deep sequencing80 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4726-3p

Accession MIMAT0019846
Sequence

37 - 

acccagguucccucuggccgca

 - 58

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).