Stem-loop sequence hsa-mir-4725

AccessionMI0017362 (change log)
Symbol HGNC:MIR4725
DescriptionHomo sapiens miR-4725 stem-loop
Literature search

1 open access papers mention hsa-mir-4725
(2 sentences)

Stem-loop
       -     ugga   c   ca        -  cca   g  ag 
5' gugu cucuc    gac cug  gccuuccc ac   cca gg  c
   |||| |||||    ||| |||  |||||||| ||   ||| ||   
3' caca gggag    cug gac  cggaaggg ug   ggu cc  u
       a     uggg   u   ug        g  ucg   a  uu 
Get sequence
Deep sequencing
137 reads, 25 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 31575269-31575358 [+]
antisense
OTTHUMT00000256378 ; ASIC2-001; intron 1
OTTHUMT00000447552 ; ASIC2-003; intron 1
OTTHUMT00000447553 ; ASIC2-004; intron 1
OTTHUMT00000256379 ; ASIC2-002; intron 2
ENST00000225823 ; ASIC2-001; intron 1
ENST00000359872 ; ASIC2-003; intron 1
ENST00000579816 ; ASIC2-004; intron 1
ENST00000448983 ; ASIC2-002; intron 2
Clustered miRNAs
< 10kb from hsa-mir-4725
hsa-mir-4725chr17: 31575269-31575358 [+]
hsa-mir-365bchr17: 31575411-31575521 [+]
Database links

Mature sequence hsa-miR-4725-5p

Accession MIMAT0019843
Sequence

13 - 

agacccugcagccuucccacc

 - 33

Get sequence
Deep sequencing14 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4725-3p

Accession MIMAT0019844
Sequence

58 - 

uggggaaggcgucagugucggg

 - 79

Get sequence
Deep sequencing108 reads, 39 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).