Stem-loop sequence hsa-mir-4724

AccessionMI0017361 (change log)
Symbol HGNC:MIR4724
DescriptionHomo sapiens miR-4724 stem-loop
Literature search

1 open access papers mention hsa-mir-4724
(2 sentences)

Stem-loop
        aaau  ---a            u a       guacauua 
5' acgca    ga    cugaaccaggag g gcuucgu        u
   |||||    ||    |||||||||||| | |||||||        c
3' ugcgu    cu    gacuuggucuuc c ugaagua        u
        gucc  gauc            - a       aaagauua 
Get sequence
Deep sequencing
170 reads, 2.86 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 31534883-31534971 [+]
antisense
OTTHUMT00000256378 ; ASIC2-001; intron 1
OTTHUMT00000447552 ; ASIC2-003; intron 1
OTTHUMT00000447553 ; ASIC2-004; intron 1
OTTHUMT00000256379 ; ASIC2-002; intron 2
ENST00000225823 ; ASIC2-001; intron 1
ENST00000359872 ; ASIC2-003; intron 1
ENST00000579816 ; ASIC2-004; intron 1
ENST00000448983 ; ASIC2-002; intron 2
Database links

Mature sequence hsa-miR-4724-5p

Accession MIMAT0019841
Sequence

11 - 

aacugaaccaggagugagcuucg

 - 33

Get sequence
Deep sequencing167 reads, 32 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4724-3p

Accession MIMAT0019842
Sequence

59 - 

guaccuucugguucagcuagu

 - 79

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).