Stem-loop sequence hsa-mir-4723

AccessionMI0017359 (change log)
Symbol HGNC:MIR4723
DescriptionHomo sapiens miR-4723 stem-loop
Literature search

1 open access papers mention hsa-mir-4723
(4 sentences)

Stem-loop
   ag    u          u    uaa a      cc   agaa 
5'   uugg gggggagcca gaga   g gcaccu  uag    u
     |||| |||||||||| ||||   | ||||||  |||    g
3'   aacc ccuccucggu cucu   c cgugga  auc    u
   ga    -          -    --c -      -a   aagu 
Get sequence
Deep sequencing
170 reads, 1.39 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 28360654-28360734 [+]
sense
OTTHUMT00000447910 ; EFCAB5-008; intron 1
OTTHUMT00000256119 ; EFCAB5-002; intron 4
OTTHUMT00000448958 ; EFCAB5-012; intron 4
OTTHUMT00000447908 ; EFCAB5-006; intron 6
OTTHUMT00000319651 ; EFCAB5-004; intron 7
OTTHUMT00000256120 ; EFCAB5-003; intron 7
OTTHUMT00000256118 ; EFCAB5-001; intron 7
ENST00000584826 ; EFCAB5-008; intron 1
ENST00000419434 ; EFCAB5-002; intron 4
ENST00000588978 ; EFCAB5-012; intron 4
ENST00000423598 ; EFCAB5-006; intron 6
ENST00000541045 ; EFCAB5-204; intron 6
ENST00000536908 ; EFCAB5-004; intron 7
ENST00000394835 ; EFCAB5-003; intron 7
ENST00000440741 ; EFCAB5-001; intron 7
ENST00000320856 ; EFCAB5-201; intron 7
ENST00000394832 ; EFCAB5-203; intron 7
ENST00000378738 ; EFCAB5-202; intron 7
Database links

Mature sequence hsa-miR-4723-5p

Accession MIMAT0019838
Sequence

7 - 

ugggggagccaugagauaagagca

 - 30

Get sequence
Deep sequencing89 reads, 46 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4723-3p

Accession MIMAT0019839
Sequence

59 - 

cccucucuggcuccuccccaaa

 - 80

Get sequence
Deep sequencing76 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).