Stem-loop sequence hsa-mir-4722

AccessionMI0017357 (change log)
Symbol HGNC:MIR4722
DescriptionHomo sapiens miR-4722 stem-loop
Stem-loop
   -g     -   -    u  c     -    gg 
5'   gcagg agg gcug gc agguu ggcu  g
     ||||| ||| |||| || ||||| ||||   
3'   cgucc ucc cgac cg uccag ccgg  c
   ga     c   a    -  -     u    ac 
Get sequence
Deep sequencing
52 reads, 12 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 88716278-88716337 [-]
sense
OTTHUMT00000422765 ; CYBA-001; intron 1
OTTHUMT00000422768 ; CYBA-009; intron 1
OTTHUMT00000422770 ; CYBA-011; intron 1
OTTHUMT00000422771 ; CYBA-005; intron 1
OTTHUMT00000422772 ; CYBA-003; intron 1
OTTHUMT00000422773 ; CYBA-004; intron 1
OTTHUMT00000422774 ; CYBA-006; intron 1
OTTHUMT00000422775 ; CYBA-010; intron 1
OTTHUMT00000422776 ; CYBA-007; intron 1
ENST00000261623 ; CYBA-001; intron 1
ENST00000566534 ; CYBA-009; intron 1
ENST00000566229 ; CYBA-011; intron 1
ENST00000567174 ; CYBA-005; intron 1
ENST00000569359 ; CYBA-003; intron 1
ENST00000563526 ; CYBA-004; intron 1
ENST00000568278 ; CYBA-006; intron 1
ENST00000562209 ; CYBA-010; intron 1
ENST00000561972 ; CYBA-007; intron 1
Database links

Mature sequence hsa-miR-4722-5p

Accession MIMAT0019836
Sequence

1 - 

ggcaggagggcugugccagguug

 - 23

Get sequence
Deep sequencing41 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4722-3p

Accession MIMAT0019837
Sequence

39 - 

accugccagcaccucccugcag

 - 60

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).