Stem-loop sequence hsa-mir-4720

AccessionMI0017355 (change log)
Symbol HGNC:MIR4720
DescriptionHomo sapiens miR-4720 stem-loop
Stem-loop
       c    -                             
5' aagc uggc auauuugguauaacuuaagcaccaggua 
   |||| |||| ||||||||||||||||||||||||||| a
3' uuug accg uaugaaccauguugaauucguggucuaa 
       a    a                             
Get sequence
Deep sequencing
14 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 81385018-81385093 [+]
sense
OTTHUMT00000269050 ; GAN-001; intron 1
ENST00000568107 ; GAN-001; intron 1
Database links

Mature sequence hsa-miR-4720-5p

Accession MIMAT0019833
Sequence

4 - 

ccuggcauauuugguauaacuu

 - 25

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4720-3p

Accession MIMAT0019834
Sequence

46 - 

ugcuuaaguuguaccaaguau

 - 66

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).