Stem-loop sequence hsa-mir-4719

AccessionMI0017354 (change log)
Symbol HGNC:MIR4719
DescriptionHomo sapiens miR-4719 stem-loop
Stem-loop
      a                            uuacauuaa 
5' aca ugaugacuuguauguuauagauuuguga         a
   ||| ||||||||||||||||||||||||||||          
3' ugu acuacuggacguauaauaucuaaacacu         a
      c                            uuaaaauuc 
Get sequence
Deep sequencing
31 reads, 41.2 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 76868936-76869019 [+]
sense
OTTHUMT00000433024 ; CTD-2336H13.2-001; intron 1
ENST00000567777 ; CTD-2336H13.2-001; intron 1
Database links

Mature sequence hsa-miR-4719

Accession MIMAT0019832
Sequence

53 - 

ucacaaaucuauaauaugcagg

 - 74

Get sequence
Deep sequencing14 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).