Stem-loop sequence hsa-mir-4718

AccessionMI0017353 (change log)
Symbol HGNC:MIR4718
DescriptionHomo sapiens miR-4718 stem-loop
Literature search

1 open access papers mention hsa-mir-4718
(3 sentences)

Stem-loop
   a   -   c     a     -   cu 
5'  gcu gua cugaa ccaag cac  g
    ||| ||| ||||| ||||| |||   
3'  cga cau gacuu gguuc gug  u
   -   u   u     c     a   uu 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 12720321-12720371 [+]
intergenic
Database links

Mature sequence hsa-miR-4718

Accession MIMAT0019831
Sequence

1 - 

agcuguaccugaaaccaagca

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).