Stem-loop sequence hsa-mir-4717

AccessionMI0017352 (change log)
Symbol HGNC:MIR4717
DescriptionHomo sapiens miR-4717 stem-loop
Literature search

2 open access papers mention hsa-mir-4717
(2 sentences)

Stem-loop
                                    gg 
5' ggcaguguuuaggccacagccacccauguguag  g
   |||||||||||||||||||||||||||||||||   
3' ccgucacaaauccggugucgguggguacacauc  u
                                    gg 
Get sequence
Deep sequencing
107 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 2274620-2274691 [+]
sense
OTTHUMT00000435225 ; E4F1-001; intron 1
OTTHUMT00000435226 ; E4F1-002; intron 1
OTTHUMT00000435228 ; E4F1-004; intron 1
OTTHUMT00000435229 ; E4F1-007; intron 1
OTTHUMT00000435230 ; E4F1-008; intron 1
ENST00000301727 ; E4F1-001; intron 1
ENST00000565090 ; E4F1-002; intron 1
ENST00000564139 ; E4F1-004; intron 1
ENST00000562589 ; E4F1-007; intron 1
ENST00000565413 ; E4F1-008; intron 1
Clustered miRNAs
< 10kb from hsa-mir-4717
hsa-mir-3677chr16: 2270713-2270772 [+]
hsa-mir-940chr16: 2271747-2271840 [+]
hsa-mir-4717chr16: 2274620-2274691 [+]
Database links

Mature sequence hsa-miR-4717-5p

Accession MIMAT0019829
Sequence

10 - 

uaggccacagccacccaugugu

 - 31

Get sequence
Deep sequencing21 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4717-3p

Accession MIMAT0019830
Sequence

42 - 

acacauggguggcuguggccu

 - 62

Get sequence
Deep sequencing86 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).