Stem-loop sequence hsa-mir-4716

AccessionMI0017350 (change log)
Symbol HGNC:MIR4716
DescriptionHomo sapiens miR-4716 stem-loop
Gene family MIPF0001476; mir-4716
Literature search

1 open access papers mention hsa-mir-4716
(2 sentences)

Stem-loop
                                    ----     c 
5' cauacuuugucuccauguuuccuucccccuucu    guaua a
   |||||||||||||||||||||||||||||||||    |||||  
3' gugugaaacagagguacaaaggaagggggaagg    cauau u
                                    agga     g 
Get sequence
Deep sequencing
119 reads, 5.26 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 49169070-49169153 [-]
sense
OTTHUMT00000417375 ; SHC4-003; 5'UTR (exon 1)
OTTHUMT00000417377 ; SHC4-005; intron 1
OTTHUMT00000417378 ; SHC4-004; intron 1
OTTHUMT00000417379 ; SHC4-006; exon 1
OTTHUMT00000417376 ; SHC4-002; intron 2
OTTHUMT00000254371 ; SHC4-001; intron 4
ENST00000396535 ; SHC4-003; 5'UTR (exon 1)
ENST00000557797 ; SHC4-005; intron 1
ENST00000558220 ; SHC4-004; intron 1
ENST00000559289 ; SHC4-006; exon 1
ENST00000537958 ; SHC4-002; intron 2
ENST00000332408 ; SHC4-001; intron 4
Database links

Mature sequence hsa-miR-4716-5p

Accession MIMAT0019826
Sequence

12 - 

uccauguuuccuucccccuucu

 - 33

Get sequence
Deep sequencing19 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4716-3p

Accession MIMAT0019827
Sequence

54 - 

aagggggaaggaaacauggaga

 - 75

Get sequence
Deep sequencing79 reads, 35 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).