Stem-loop sequence hsa-mir-4715

AccessionMI0017349 (change log)
Symbol HGNC:MIR4715
DescriptionHomo sapiens miR-4715 stem-loop
Literature search

1 open access papers mention hsa-mir-4715
(5 sentences)

Stem-loop
          gaa                      -ua   a 
5' ggggaau   aguuggcugcaguuaagguggc   auc g
   |||||||   ||||||||||||||||||||||   |||  
3' ccccuua   uuaaccgacgucaauuccaccg   uag c
          auc                      ugg   u 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 25848747-25848825 [-]
intergenic
Database links

Mature sequence hsa-miR-4715-5p

Accession MIMAT0019824
Sequence

10 - 

aaguuggcugcaguuaaggugg

 - 31

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4715-3p

Accession MIMAT0019825
Sequence

46 - 

gugccaccuuaacugcagccaau

 - 68

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).