Stem-loop sequence hsa-mir-4714

AccessionMI0017348 (change log)
Symbol HGNC:MIR4714
DescriptionHomo sapiens miR-4714 stem-loop
Stem-loop
                      c         ----  g  a 
5' auuuuggccaacucugacc cuuagguug    au uc g
   ||||||||||||||||||| |||||||||    || || a
3' uaaaaccgguugagacugg ggauccaac    ug ag a
                      u         caug  g  u 
Get sequence
Deep sequencing
130 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 98784426-98784502 [+]
antisense
OTTHUMT00000415495 ; CTD-2544M6.1-001; intron 3
ENST00000560360 ; CTD-2544M6.1-001; intron 3
Database links

Mature sequence hsa-miR-4714-5p

Accession MIMAT0019822
Sequence

10 - 

aacucugaccccuuagguugau

 - 31

Get sequence
Deep sequencing56 reads, 34 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4714-3p

Accession MIMAT0019823
Sequence

48 - 

ccaaccuagguggucagaguug

 - 69

Get sequence
Deep sequencing56 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).