Stem-loop sequence hsa-mir-4713

AccessionMI0017347 (change log)
Symbol HGNC:MIR4713
DescriptionHomo sapiens miR-4713 stem-loop
Literature search

1 open access papers mention hsa-mir-4713
(2 sentences)

Stem-loop
                       ac a  c      aag 
5' guccccauuuuucucccacu  c gg ucccau   g
   ||||||||||||||||||||  | || ||||||   g
3' cagggguaaaaagaggguga  g cc agggua   u
                       ca a  u      agc 
Get sequence
Deep sequencing
149 reads, 4.17 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 51242190-51242264 [+]
sense
OTTHUMT00000418654 ; AP4E1-003; exon 12
OTTHUMT00000418653 ; AP4E1-005; exon 13
OTTHUMT00000418655 ; AP4E1-004; exon 13
OTTHUMT00000418656 ; AP4E1-001; 3'UTR (exon 13)
OTTHUMT00000418657 ; AP4E1-002; 3'UTR (exon 13)
ENST00000561393 ; AP4E1-003; exon 12
ENST00000561441 ; AP4E1-005; exon 13
ENST00000558439 ; AP4E1-004; exon 13
ENST00000261842 ; AP4E1-001; 3'UTR (exon 13)
ENST00000560508 ; AP4E1-002; 3'UTR (exon 13)
Database links

Mature sequence hsa-miR-4713-5p

Accession MIMAT0019820
Sequence

11 - 

uucucccacuaccaggcuccca

 - 32

Get sequence
Deep sequencing133 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4713-3p

Accession MIMAT0019821
Sequence

44 - 

ugggauccagacagugggagaa

 - 65

Get sequence
Deep sequencing14 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).