Stem-loop sequence hsa-mir-4712

AccessionMI0017346 (change log)
Symbol HGNC:MIR4712
DescriptionHomo sapiens miR-4712 stem-loop
Stem-loop
         auuc                    cuucau  u   g 
5' gacagg    caguacaggucucucauuuc      ga uag a
   ||||||    ||||||||||||||||||||      || ||| a
3' uugucu    gucauguccagagaguaaag      uu auc u
         --au                    -----u  c   a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 50360329-50360410 [+]
antisense
OTTHUMT00000418112 ; ATP8B4-008; intron 1
OTTHUMT00000418099 ; ATP8B4-007; intron 3
OTTHUMT00000418100 ; ATP8B4-001; intron 3
OTTHUMT00000418102 ; ATP8B4-003; intron 3
OTTHUMT00000418103 ; ATP8B4-002; intron 3
OTTHUMT00000418114 ; ATP8B4-009; intron 3
ENST00000560437 ; ATP8B4-008; intron 1
ENST00000559726 ; ATP8B4-007; intron 3
ENST00000559829 ; ATP8B4-001; intron 3
ENST00000557955 ; ATP8B4-003; intron 3
ENST00000558906 ; ATP8B4-002; intron 3
ENST00000558829 ; ATP8B4-009; intron 3
ENST00000284509 ; ATP8B4-201; intron 3
Database links

Mature sequence hsa-miR-4712-5p

Accession MIMAT0019818
Sequence

9 - 

uccaguacaggucucucauuuc

 - 30

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4712-3p

Accession MIMAT0019819
Sequence

57 - 

aaugagagaccuguacuguau

 - 77

Get sequence
Deep sequencing26 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).