Stem-loop sequence hsa-mir-4711

AccessionMI0017345 (change log)
Symbol HGNC:MIR4711
DescriptionHomo sapiens miR-4711 stem-loop
Literature search

2 open access papers mention hsa-mir-4711
(4 sentences)

Stem-loop
                               c    u 
5' aaaugugcaucaggccagaagacaugag ccuu g
   |||||||||||||||||||||||||||| ||||  
3' uuuacacguaguucggucuucugugcuc ggaa g
                               u    a 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 59733227-59733296 [-]
intergenic
Database links

Mature sequence hsa-miR-4711-5p

Accession MIMAT0019816
Sequence

6 - 

ugcaucaggccagaagacaugag

 - 28

Get sequence
Deep sequencing26 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4711-3p

Accession MIMAT0019817
Sequence

45 - 

cgugucuucuggcuugau

 - 62

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).