Stem-loop sequence hsa-mir-4708

AccessionMI0017341 (change log)
Symbol HGNC:MIR4708
DescriptionHomo sapiens miR-4708 stem-loop
Literature search

1 open access papers mention hsa-mir-4708
(1 sentences)

Stem-loop
   u    ---g                       ga 
5'  uuag    agagagaugccgccuugcuccuu  a
    ||||    |||||||||||||||||||||||   
3'  aauc    ucucucuacggcggaacgaggag  c
   a    auag                       ga 
Get sequence
Deep sequencing
85 reads, 8.33 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 65335117-65335183 [-]
sense
OTTHUMT00000414076 ; SPTB-001; intron 1
ENST00000556626 ; SPTB-001; intron 1
ENST00000542895 ; SPTB-202; intron 1
Database links

Mature sequence hsa-miR-4708-5p

Accession MIMAT0019809
Sequence

9 - 

agagaugccgccuugcuccuu

 - 29

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4708-3p

Accession MIMAT0019810
Sequence

40 - 

agcaaggcggcaucucucugau

 - 61

Get sequence
Deep sequencing71 reads, 27 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).