Stem-loop sequence hsa-mir-4707

AccessionMI0017340 (change log)
Symbol HGNC:MIR4707
DescriptionHomo sapiens miR-4707 stem-loop
Literature search

6 open access papers mention hsa-mir-4707
(8 sentences)

Stem-loop
      u   -     c    gc         -- ug -    u 
5' ggu ccg gagcc cggc  gggcggguu  c  g ggug a
   ||| ||| ||||| ||||  |||||||||  |  | ||||  
3' cca ggc cuugg gccg  cccgcccga  g  c ucgc g
      c   u     a    ac         cc gu g    a 
Get sequence
Deep sequencing
291 reads, 0 reads per million, 82 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 22956950-22957029 [-]
intergenic
Database links

Mature sequence hsa-miR-4707-5p

Accession MIMAT0019807
Sequence

10 - 

gccccggcgcgggcggguucugg

 - 32

Get sequence
Deep sequencing48 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4707-3p

Accession MIMAT0019808
Sequence

52 - 

agcccgccccagccgagguucu

 - 73

Get sequence
Deep sequencing238 reads, 70 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).