Stem-loop sequence hsa-mir-4704

AccessionMI0017337 (change log)
Symbol HGNC:MIR4704
DescriptionHomo sapiens miR-4704 stem-loop
Stem-loop
        c           gc      g      ucuu 
5' cuuau cuagacacuag  auguga ugauug    c
   ||||| |||||||||||  |||||| ||||||    c
3' gagua gaucugugauc  uacacu acuaac    u
        a           ua      g      ucac 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 66218250-66218324 [+]
intergenic
Database links

Mature sequence hsa-miR-4704-5p

Accession MIMAT0019803
Sequence

10 - 

gacacuaggcaugugagugauu

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4704-3p

Accession MIMAT0019804
Sequence

47 - 

ucagucacauaucuagugucua

 - 68

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).