Stem-loop sequence hsa-mir-4703

AccessionMI0017336 (change log)
Symbol HGNC:MIR4703
DescriptionHomo sapiens miR-4703 stem-loop
Gene family MIPF0001759; mir-4703
Literature search

1 open access papers mention hsa-mir-4703
(2 sentences)

Stem-loop
   u      uauua              a         uu 
5'  uaugca     gcaauacaguacaa uauagugug  u
    ||||||     |||||||||||||| |||||||||  g
3'  auaugu     cguuauguuauguu augucacgu  a
   a      cucac              g         uu 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 51552589-51552667 [+]
intergenic
Database links

Mature sequence hsa-miR-4703-5p

Accession MIMAT0019801
Sequence

11 - 

uagcaauacaguacaaauauagu

 - 33

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4703-3p

Accession MIMAT0019802
Sequence

49 - 

uguaguuguauuguauugccac

 - 70

Get sequence
Deep sequencing72 reads, 39 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).