Stem-loop sequence hsa-mir-4701

AccessionMI0017334 (change log)
Symbol HGNC:MIR4701
DescriptionHomo sapiens miR-4701 stem-loop
Literature search

1 open access papers mention hsa-mir-4701
(3 sentences)

Stem-loop
   ccu   c           - -   -    gaa 
5'    ugg caccacaccua c ccc uugu   u
      ||| ||||||||||| | ||| ||||   g
3'    acc guggugugggu g ggg aacg   u
   -ac   u           a u   u    ggc 
Get sequence
Deep sequencing
56 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 48771975-48772037 [-]
antisense
OTTHUMT00000406529 ; RP11-370I10.6-001; intron 3
ENST00000548257 ; RP11-370I10.6-001; intron 3
Database links

Mature sequence hsa-miR-4701-5p

Accession MIMAT0019798
Sequence

3 - 

uuggccaccacaccuaccccuu

 - 24

Get sequence
Deep sequencing37 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4701-3p

Accession MIMAT0019799
Sequence

39 - 

augggugauggguguggugu

 - 58

Get sequence
Deep sequencing19 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).