Stem-loop sequence hsa-mir-4700

AccessionMI0017333 (change log)
Symbol HGNC:MIR4700
DescriptionHomo sapiens miR-4700 stem-loop
Stem-loop
   --uca   aggu      a      ca  gu      aa 
5'      gug    cugggg ugagga  gu  guccug  a
        |||    |||||| ||||||  ||  ||||||  u
3'      cac    gacccc acuccu  ca  caggac  u
   aggag   --gu      -      --  gu      ac 
Get sequence
Deep sequencing
164 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 120723193-120723266 [+]
intergenic
Database links

Mature sequence hsa-miR-4700-5p

Accession MIMAT0019796
Sequence

10 - 

ucuggggaugaggacagugugu

 - 31

Get sequence
Deep sequencing48 reads, 20 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4700-3p

Accession MIMAT0019797
Sequence

41 - 

cacaggacugacuccucaccccagug

 - 66

Get sequence
Deep sequencing14 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).