Stem-loop sequence hsa-mir-4699

AccessionMI0017332 (change log)
Symbol HGNC:MIR4699
DescriptionHomo sapiens miR-4699 stem-loop
Stem-loop
                                  ugauu 
5' agcaauuggagaagauugcagaguaaguucc     a
   |||||||||||||||||||||||||||||||      
3' ucguuaaccucuucuaacgucucauuuaagg     a
                                  uaaag 
Get sequence
Deep sequencing
70 reads, 29.7 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 81158388-81158461 [+]
sense
OTTHUMT00000407759 ; RP11-540D4.3-001; intron 1
OTTHUMT00000407758 ; RP11-540D4.3-002; intron 3
ENST00000551399 ; RP11-540D4.3-001; intron 1
ENST00000548705 ; RP11-540D4.3-002; intron 3
Database links

Mature sequence hsa-miR-4699-5p

Accession MIMAT0019794
Sequence

10 - 

agaagauugcagaguaaguucc

 - 31

Get sequence
Deep sequencing36 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4699-3p

Accession MIMAT0019795
Sequence

46 - 

aauuuacucugcaaucuucucc

 - 67

Get sequence
Deep sequencing34 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).