Stem-loop sequence hsa-mir-4698

AccessionMI0017331 (change log)
Symbol HGNC:MIR4698
DescriptionHomo sapiens miR-4698 stem-loop
Stem-loop
   u      c                     cc      ac 
5'  gcuucu cuggggucuuccucuacauuu  accuag  g
    |||||| |||||||||||||||||||||  ||||||   
3'  cgagga gaccccagaaggagauguaaa  uggguc  g
   a      a                     ac      cg 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 47187812-47187891 [+]
antisense
OTTHUMT00000404574 ; SLC38A4-001; intron 1
OTTHUMT00000404578 ; SLC38A4-003; intron 1
OTTHUMT00000404575 ; SLC38A4-002; intron 2
OTTHUMT00000404577 ; SLC38A4-004; intron 2
ENST00000447411 ; SLC38A4-001; intron 1
ENST00000546940 ; SLC38A4-003; intron 1
ENST00000266579 ; SLC38A4-002; intron 2
ENST00000547477 ; SLC38A4-004; intron 2
Database links

Mature sequence hsa-miR-4698

Accession MIMAT0019793
Sequence

49 - 

ucaaaauguagaggaagacccca

 - 71

Get sequence
Deep sequencing20 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).