Stem-loop sequence hsa-mir-4694

AccessionMI0017327 (change log)
Symbol HGNC:MIR4694
DescriptionHomo sapiens miR-4694 stem-loop
Stem-loop
                        a        c    cuca 
5' caaauacauagguguuauccu uccauuug cucu    g
   ||||||||||||||||||||| |||||||| ||||     
3' guuuauguauccacaauagga agguaaac gaga    a
                        c        u    uaaa 
Get sequence
Deep sequencing
10 reads, 75 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 19760004-19760083 [-]
antisense
OTTHUMT00000389876 ; NAV2-008; intron 1
OTTHUMT00000324113 ; NAV2-002; intron 1
OTTHUMT00000324114 ; NAV2-003; intron 1
OTTHUMT00000324112 ; NAV2-001; intron 1
ENST00000360655 ; NAV2-008; intron 1
ENST00000396085 ; NAV2-002; intron 1
ENST00000349880 ; NAV2-003; intron 1
ENST00000396087 ; NAV2-001; intron 1
Database links

Mature sequence hsa-miR-4694-5p

Accession MIMAT0019786
Sequence

10 - 

agguguuauccuauccauuugc

 - 31

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4694-3p

Accession MIMAT0019787
Sequence

51 - 

caaauggacaggauaacaccu

 - 71

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).