Stem-loop sequence hsa-mir-4693

AccessionMI0017326 (change log)
Symbol HGNC:MIR4693
DescriptionHomo sapiens miR-4693 stem-loop
Literature search

1 open access papers mention hsa-mir-4693
(1 sentences)

Stem-loop
       aaa                   g    aaauu 
5' guuu   gaauacugugaauuucacu ucac     c
   ||||   ||||||||||||||||||| ||||     a
3' uaag   uuuaugacacuuaagguga agug     a
       gaa                   g    aaaua 
Get sequence
Deep sequencing
61 reads, 5.71 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 103849906-103849980 [+]
antisense
OTTHUMT00000387231 ; PDGFD-001; intron 3
OTTHUMT00000387322 ; PDGFD-002; intron 3
OTTHUMT00000387323 ; PDGFD-003; intron 3
ENST00000393158 ; PDGFD-001; intron 3
ENST00000302251 ; PDGFD-002; intron 3
ENST00000529268 ; PDGFD-003; intron 3
Database links

Mature sequence hsa-miR-4693-5p

Accession MIMAT0019784
Sequence

10 - 

auacugugaauuucacugucaca

 - 32

Get sequence
Deep sequencing31 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4693-3p

Accession MIMAT0019785
Sequence

46 - 

ugagaguggaauucacaguauuu

 - 68

Get sequence
Deep sequencing28 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).