Stem-loop sequence hsa-mir-4692

AccessionMI0017325 (change log)
Symbol HGNC:MIR4692
DescriptionHomo sapiens miR-4692 stem-loop
Stem-loop
         c                         
5' guuuua uugauacccacacugccugggugg 
   |||||| ||||||||||||||||||||||| g
3' caaaau gacuaugggugugacggacucaca 
         a                         
Get sequence
Deep sequencing
10 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 72783530-72783592 [+]
antisense
OTTHUMT00000329378 ; FCHSD2-001; intron 2
OTTHUMT00000329430 ; FCHSD2-003; intron 3
OTTHUMT00000329429 ; FCHSD2-002; intron 3
OTTHUMT00000397326 ; FCHSD2-008; intron 3
OTTHUMT00000329431 ; FCHSD2-004; intron 3
OTTHUMT00000329432 ; FCHSD2-005; intron 3
ENST00000311172 ; FCHSD2-001; intron 2
ENST00000409314 ; FCHSD2-003; intron 3
ENST00000409418 ; FCHSD2-002; intron 3
ENST00000458644 ; FCHSD2-008; intron 3
ENST00000409853 ; FCHSD2-004; intron 3
ENST00000422375 ; FCHSD2-005; intron 3
Database links

Mature sequence hsa-miR-4692

Accession MIMAT0019783
Sequence

37 - 

ucaggcaguguggguaucagau

 - 58

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).