Stem-loop sequence hsa-mir-4691

AccessionMI0017324 (change log)
Symbol HGNC:MIR4691
DescriptionHomo sapiens miR-4691 stem-loop
Literature search

1 open access papers mention hsa-mir-4691
(1 sentences)

Stem-loop
      g      cag uc   -   g  a  a    c  cccu a 
5' gga cacucc   g  cuc cag cc ug gcug gg    g u
   ||| ||||||   |  ||| ||| || || |||| ||    |  
3' ccu gugagg   c  gag guc gg ac cgac uc    c g
      -      aua gu   a   a  c  -    c  aucu u 
Get sequence
Deep sequencing
76 reads, 9.52 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 68033897-68033981 [+]
antisense
OTTHUMT00000394750 ; C11orf24-001; intron 2
OTTHUMT00000394752 ; C11orf24-002; intron 2
OTTHUMT00000394753 ; C11orf24-007; intron 2
OTTHUMT00000394754 ; C11orf24-006; intron 2
ENST00000304271 ; C11orf24-001; intron 2
ENST00000533310 ; C11orf24-002; intron 2
ENST00000530166 ; C11orf24-007; intron 2
ENST00000527280 ; C11orf24-006; intron 2
Clustered miRNAs
< 10kb from hsa-mir-4691
hsa-mir-7113chr11: 68032864-68032922 [+]
hsa-mir-4691chr11: 68033897-68033981 [+]
Database links

Mature sequence hsa-miR-4691-5p

Accession MIMAT0019781
Sequence

14 - 

guccuccaggccaugagcugcgg

 - 36

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4691-3p

Accession MIMAT0019782
Sequence

53 - 

ccagccacggacugagagugcau

 - 75

Get sequence
Deep sequencing69 reads, 19 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).