Stem-loop sequence hsa-mir-4690

AccessionMI0017323 (change log)
Symbol HGNC:MIR4690
DescriptionHomo sapiens miR-4690 stem-loop
Literature search

1 open access papers mention hsa-mir-4690
(1 sentences)

Stem-loop
   -g  c    -ga          a  -  gug 
5'   ag aggc   ggcugggcug ac cc   g
     || ||||   |||||||||| || ||    
3'   uc uccg   ucgacccgac ug gg   g
   cg  -    gag          g  a  agu 
Get sequence
Deep sequencing
83 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 65636310-65636369 [+]
antisense
OTTHUMT00000391855 ; EFEMP2-003; exon 1
OTTHUMT00000391859 ; EFEMP2-014; intron 1
OTTHUMT00000391860 ; EFEMP2-006; intron 3
OTTHUMT00000391861 ; EFEMP2-004; exon 4
OTTHUMT00000391046 ; EFEMP2-002; intron 7
OTTHUMT00000391858 ; EFEMP2-007; intron 7
OTTHUMT00000391047 ; EFEMP2-001; intron 7
ENST00000526628 ; EFEMP2-003; exon 1
ENST00000532084 ; EFEMP2-014; intron 1
ENST00000531005 ; EFEMP2-006; intron 3
ENST00000527969 ; EFEMP2-004; exon 4
ENST00000531972 ; EFEMP2-002; intron 7
ENST00000528176 ; EFEMP2-007; intron 7
ENST00000307998 ; EFEMP2-001; intron 7
Database links

Mature sequence hsa-miR-4690-5p

Accession MIMAT0019779
Sequence

1 - 

gagcaggcgaggcugggcugaa

 - 22

Get sequence
Deep sequencing14 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4690-3p

Accession MIMAT0019780
Sequence

39 - 

gcagcccagcugaggccucug

 - 59

Get sequence
Deep sequencing44 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).