Stem-loop sequence hsa-mir-4689

AccessionMI0017322 (change log)
Symbol HGNC:MIR4689
DescriptionHomo sapiens miR-4689 stem-loop
Literature search

2 open access papers mention hsa-mir-4689
(64 sentences)

Stem-loop
            u      g       --   -g   g 
5' gguuucucc ugagga acauggu  ggg  gcc g
   ||||||||| |||||| |||||||  |||  ||| u
3' ccggagagg acuccu uguaccg  ccc  cgg c
            u      g       ua   ga   a 
Get sequence
Deep sequencing
141 reads, 30.4 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 5862672-5862741 [-]
intergenic
Database links

Mature sequence hsa-miR-4689

Accession MIMAT0019778
Sequence

10 - 

uugaggagacauggugggggcc

 - 31

Get sequence
Deep sequencing136 reads, 46 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).