Stem-loop sequence hsa-mir-4688

AccessionMI0017321 (change log)
Symbol HGNC:MIR4688
DescriptionHomo sapiens miR-4688 stem-loop
Stem-loop
        cu      gug  aag    uucg   u    c   a     
5' gucua  cccagg   cc   cugu    ugu cccu ccu gggg 
   |||||  ||||||   ||   ||||    ||| |||| ||| ||| a
3' caggu  gggucc   gg   gacg    acg ggga gga cccu 
        cc      --a  --a    ----   -    u   -     
Get sequence
Deep sequencing
245 reads, 50.8 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 46376402-46376484 [+]
sense
OTTHUMT00000389770 ; DGKZ-001; intron 1
OTTHUMT00000389994 ; DGKZ-012; intron 1
OTTHUMT00000389998 ; DGKZ-005; intron 1
OTTHUMT00000389771 ; DGKZ-003; intron 1
OTTHUMT00000389995 ; DGKZ-004; intron 1
OTTHUMT00000389996 ; DGKZ-006; intron 1
OTTHUMT00000389997 ; DGKZ-007; intron 1
OTTHUMT00000389999 ; DGKZ-008; intron 1
OTTHUMT00000390000 ; DGKZ-016; intron 1
OTTHUMT00000398328 ; DGKZ-022; intron 1
OTTHUMT00000398329 ; DGKZ-023; intron 1
ENST00000343674 ; DGKZ-001; intron 1
ENST00000525242 ; DGKZ-012; intron 1
ENST00000532868 ; DGKZ-005; intron 1
ENST00000528615 ; DGKZ-003; intron 1
ENST00000531879 ; DGKZ-004; intron 1
ENST00000527674 ; DGKZ-006; intron 1
ENST00000524984 ; DGKZ-007; intron 1
ENST00000527911 ; DGKZ-008; intron 1
ENST00000533376 ; DGKZ-016; intron 1
ENST00000456247 ; DGKZ-022; intron 1
ENST00000421244 ; DGKZ-023; intron 1
ENST00000395574 ; DGKZ-202; intron 1
ENST00000543978 ; DGKZ-203; intron 1
ENST00000318201 ; DGKZ-201; intron 1
Database links

Mature sequence hsa-miR-4688

Accession MIMAT0019777
Sequence

55 - 

uaggggcagcagaggaccuggg

 - 76

Get sequence
Deep sequencing221 reads, 45 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).