Stem-loop sequence hsa-mir-4686

AccessionMI0017318 (change log)
Symbol HGNC:MIR4686
DescriptionHomo sapiens miR-4686 stem-loop
Literature search

1 open access papers mention hsa-mir-4686
(2 sentences)

Stem-loop
         cu  a            ucu      gg ag 
5' ggcuuc  gu ucugcugggcuu   gguguu  c  c
   ||||||  || ||||||||||||   ||||||  |  c
3' ccgaag  cg ggacgacccggg   ccacag  g  c
         ac  a            -uc      ua aa 
Get sequence
Deep sequencing
21 reads, 18.8 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 2173063-2173138 [+]
antisense
OTTHUMT00000026387 ; INS-IGF2-003; intron 1
OTTHUMT00000026388 ; INS-IGF2-005; intron 1
OTTHUMT00000026061 ; INS-IGF2-002; intron 2
OTTHUMT00000388404 ; INS-IGF2-001; intron 2
ENST00000481781 ; INS-IGF2-003; intron 1
ENST00000476874 ; INS-IGF2-005; intron 1
ENST00000356578 ; INS-IGF2-002; intron 2
ENST00000397270 ; INS-IGF2-001; intron 2
Database links

Mature sequence hsa-miR-4686

Accession MIMAT0019773
Sequence

10 - 

uaucugcugggcuuucugguguu

 - 32

Get sequence
Deep sequencing13 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).