Stem-loop sequence hsa-mir-4685

AccessionMI0017317 (change log)
Symbol HGNC:MIR4685
DescriptionHomo sapiens miR-4685 stem-loop
Literature search

2 open access papers mention hsa-mir-4685
(5 sentences)

Stem-loop
   -     c     uu   gu    ca   uu    gu 
5'  uagcc agggc  gga  gggg  agg  guug  g
    ||||| |||||  |||  ||||  |||  ||||   
3'  aucgg ucccg  ccu  uccc  ucc  cggu  a
   g     -     -u   --    uc   uu    au 
Get sequence
Deep sequencing
145 reads, 26.8 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 98431292-98431360 [-]
sense
OTTHUMT00000049621 ; PIK3AP1-003; intron 1
OTTHUMT00000049619 ; PIK3AP1-001; intron 2
ENST00000468783 ; PIK3AP1-003; intron 1
ENST00000339364 ; PIK3AP1-001; intron 2
Database links

Mature sequence hsa-miR-4685-5p

Accession MIMAT0019771
Sequence

4 - 

cccagggcuuggaguggggcaagguu

 - 29

Get sequence
Deep sequencing18 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4685-3p

Accession MIMAT0019772
Sequence

48 - 

ucucccuuccugcccuggcuag

 - 69

Get sequence
Deep sequencing120 reads, 54 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).