Stem-loop sequence hsa-mir-4684

AccessionMI0017316 (change log)
Symbol HGNC:MIR4684
DescriptionHomo sapiens miR-4684 stem-loop
Stem-loop
                c                      auuu 
5' gcaccagggguac ucucuacugacuugcaacauac    g
   ||||||||||||| ||||||||||||||||||||||     
3' cgugguucccaug agagguggcugaacguugugug    u
                c                      guuc 
Get sequence
Deep sequencing
177 reads, 2.17 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 22719517-22719598 [+]
intergenic
Database links

Mature sequence hsa-miR-4684-5p

Accession MIMAT0019769
Sequence

14 - 

cucucuacugacuugcaacaua

 - 35

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4684-3p

Accession MIMAT0019770
Sequence

50 - 

uguugcaagucgguggagacgu

 - 71

Get sequence
Deep sequencing30 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).