Stem-loop sequence hsa-mir-4682

AccessionMI0017314 (change log)
Symbol HGNC:MIR4682
DescriptionHomo sapiens miR-4682 stem-loop
Stem-loop
   ---ug       --u       cc      -    u  gu a 
5'      ccccugg   cugaguu  uggagc cugg cu  c c
        |||||||   |||||||  |||||| |||| ||  | u
3'      ggggacc   gacucgg  accucg gacc ga  g g
   acgca       cgu       -a      a    u  ag g 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 119958513-119958592 [+]
sense
OTTHUMT00000050580 ; CASC2-004; intron 2
OTTHUMT00000050581 ; CASC2-005; intron 3
OTTHUMT00000050577 ; CASC2-001; intron 3
OTTHUMT00000050582 ; CASC2-006; intron 3
ENST00000439517 ; CASC2-004; intron 2
ENST00000414722 ; CASC2-005; intron 3
ENST00000435944 ; CASC2-001; intron 3
ENST00000454857 ; CASC2-006; intron 3
Database links

Mature sequence hsa-miR-4682

Accession MIMAT0019767
Sequence

10 - 

ucugaguuccuggagccuggucu

 - 32

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).