Stem-loop sequence hsa-mir-4681

AccessionMI0017313 (change log)
Symbol HGNC:MIR4681
DescriptionHomo sapiens miR-4681 stem-loop
Literature search

1 open access papers mention hsa-mir-4681
(1 sentences)

Stem-loop
      ----a     aa     g         cag   a 
5' ggc     acggg  ugcag cuguaucug   ggc u
   |||     |||||  ||||| |||||||||   ||| u
3' ccg     ugucc  acguc gacguggac   ucg g
      gacac     ag     g         -aa   u 
Get sequence
Deep sequencing
22 reads, 19 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 119377972-119378043 [+]
intergenic
Database links

Mature sequence hsa-miR-4681

Accession MIMAT0019766
Sequence

4 - 

aacgggaaugcaggcuguaucu

 - 25

Get sequence
Deep sequencing15 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).