Stem-loop sequence hsa-mir-4680

AccessionMI0017312 (change log)
Symbol HGNC:MIR4680
DescriptionHomo sapiens miR-4680 stem-loop
Gene family MIPF0001988; mir-4680
Literature search

1 open access papers mention hsa-mir-4680
(1 sentences)

Stem-loop
   --ua   g            c        u   a 
5'     uaa aacucuugcagu uuagaugu aua a
       ||| |||||||||||| |||||||| |||  
3'     auu uugagaauguua agucuaua uau a
   cacg   g            -        -   a 
Get sequence
Deep sequencing
79 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 110898090-110898155 [+]
intergenic
Database links

Mature sequence hsa-miR-4680-5p

Accession MIMAT0019764
Sequence

5 - 

agaacucuugcagucuuagaugu

 - 27

Get sequence
Deep sequencing31 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4680-3p

Accession MIMAT0019765
Sequence

42 - 

ucugaauuguaagaguuguua

 - 62

Get sequence
Deep sequencing35 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).